Showing 140 of 219 total issues
Function __init__ has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def __init__(self, record, *args, amplicon=None, position=None, footprint=0, **kwargs):Function __str__ has a Cognitive Complexity of 8 (exceeds 5 allowed). Consider refactoring. Open
def __str__(self):
"""returns a short report describing if or where primer
anneal on the template."""
mystring = "Template {name} {size} bp {top} limit={limit}:\n".format(- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function reduced_field has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def reduced_field(eta, a, mu0, E, kB, T):Function reduced_field_Kuhn has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def reduced_field_Kuhn(eta, l, mu0, E, kB, T):Function __init__ has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def __init__(self, record, *args, template=None, forward_primer=None, reverse_primer=None, **kwargs):Avoid deeply nested control flow statements. Open
if isinstance(val, str):
dct[key] = a[key].strip()
nl.append(dct)Function from_SeqRecord has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def from_SeqRecord(Function __init__ has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def __init__(self, seq, *args, id="id", name="name", description="description", **kwargs):Function translate has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def translate(self, table="Standard", stop_symbol="*", to_stop=False, cds=False, gap="-"):Function __init__ has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def __init__(self, record, *args, graph=None, nodemap=None, **kwargs):Function pore_size has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def pore_size(gamma, muL, mu0, lp, b):Function tmbresluc has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def tmbresluc(primer: str, *args, primerc=500.0, saltc=50, **kwargs):Function from_string has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def from_string(Function ta_dbd has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def ta_dbd(fp, rp, seq, tm=tm_dbd, tm_product=None):Function __init__ has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def __init__(Function all_simple_paths_edges has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def all_simple_paths_edges(G, source, target, cutoff=None, data=False):Function from_SeqRecord has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def from_SeqRecord(cls, record, *args, graph=None, nodemap=None, **kwargs):Function ta_default has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def ta_default(fp: str, rp: str, seq: str, tm=tm_default, tm_product=tm_product):Function diffusion_coefficient has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def diffusion_coefficient(Nbp, N_lim1, N_lim2, N_lim3, args):Function from_string has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def from_string(cls, record: str = "", *args, graph=None, nodemap=None, **kwargs):Function quick has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def quick(Function list_parts has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def list_parts(fusion_pcr_fragment):
stack = [fusion_pcr_fragment]
processed = []
while stack:- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function find_aminoacids has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def find_aminoacids(self, other):
"""
>>> from pydna.dseqrecord import Dseqrecord
>>> s=Dseqrecord("atgtacgatcgtatgctggttatattttag")
>>> s.seq.translate()- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function _fill_in_three_prime has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def _fill_in_three_prime(self, nucleotides):
stuffer = ""
type, se = self.three_prime_end()
if type == "5'":
for n in _rc(se):- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function assign_numbers has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def assign_numbers(self, lst: list):
"""Find new primers in lst.
Returns a string containing new primers with their assigned
numbers. This string can be copied and pasted to the primer- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function figure has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def figure(self, feature=0, highlight="\x1b[48;5;11m", plain="\x1b[0m"):
"""docstring."""
if self.features:
f = self.features[feature]
locations = sorted(self.features[feature].location.parts, key=_SimpleLocation.start.fget)- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function __add__ has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def __add__(self, other):
"""Simulates ligation between two DNA fragments.
Add other Dseq object at the end of the sequence.
Type error is raised if any of the points below are fulfilled:- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function search has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def search(self, dna, linear=True):
"""docstring."""
dna = str(dna).upper()
if linear:
dna = dna- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function _fill_in_five_prime has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def _fill_in_five_prime(self, nucleotides):
stuffer = ""
type, se = self.five_prime_end()
if type == "5'":
for n in _rc(se):- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function memorize has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def memorize(filename):
"""Cache functions and classes.
see pydna.download
"""- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function flatten has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def flatten(List):
if List == []:
return List
flatL = []
for elem in List:- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Avoid too many return statements within this function. Open
return TrueFunction parseGBLoc has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring. Open
def parseGBLoc(s, l_, t):
"""retwingles parsed genbank location strings, assumes no joins of RC and FWD sequences"""
strand = 1
locationlist = []
- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function __mul__ has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring. Open
def __mul__(self, number):
if not isinstance(number, int):
raise TypeError("TypeError: can't multiply Dseqrecord by non-int of type {}".format(type(number)))
if self.circular:
raise TypeError("TypeError: can't multiply circular Dseqrecord.")- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function expose has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring. Open
def expose(self, exposure=0.1, aperture=2):
"""Returns an image of the gel with the DNA highlighted"""
c1, c2 = exposure * 100, exposure * 200
fill_colour = (c1, c1, c2)- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function parse has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring. Open
def parse(data, ds=True):
"""Return *all* DNA sequences found in data.
If no sequences are found, an empty list is returned. This is a greedy
function, use carefully.- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function __call__ has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring. Open
def __call__(cls, *args):
t = (int(time.time()) // 10000) * 10000
h = hash(args)
fn = "%s/%s-%i-%i.pickle" % (tempfile.gettempdir(), cls.__name__, t, h)
- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function expose has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring. Open
def expose(self, exposure=0.1, aperture=2):
"""Returns an image of the gel with the DNA highlighted"""
c1, c2 = exposure * 100, exposure * 200
fill_colour = (c1, c1, c2)- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function figure has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring. Open
def figure(self):
r"""Compact ascii representation of the assembled fragments.
Each fragment is represented by:
- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function __init__ has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring. Open
def __init__(
self,
initlist: Iterable = None,
path: (str, Path) = None,
*args,- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"