Sign upLogin

BjornFJohansson/pydna

View on GitHub
Star

Showing 140 of 219 total issues

Function from_string has 5 arguments (exceeds 4 allowed). Consider refactoring.
Open

    def from_string(cls, record: str = "", *args, graph=None, nodemap=None, **kwargs):
Severity: Minor
Found in src/pydna/contig.py - About 35 mins to fix

    Function find_aminoacids has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
    Open

        def find_aminoacids(self, other):
        """
        >>> from pydna.dseqrecord import Dseqrecord
        >>> s=Dseqrecord("atgtacgatcgtatgctggttatattttag")
        >>> s.seq.translate()
    Severity: Minor
    Found in src/pydna/dseqrecord.py - About 35 mins to fix

    Cognitive Complexity

    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

    A method's cognitive complexity is based on a few simple rules:

    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
    • Code is considered more complex for each "break in the linear flow of the code"
    • Code is considered more complex when "flow breaking structures are nested"

    Further reading

    Function search has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
    Open

        def search(self, dna, linear=True):
        """docstring."""
        dna = str(dna).upper()
        if linear:
            dna = dna
    Severity: Minor
    Found in src/pydna/crispr.py - About 35 mins to fix

    Cognitive Complexity

    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

    A method's cognitive complexity is based on a few simple rules:

    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
    • Code is considered more complex for each "break in the linear flow of the code"
    • Code is considered more complex when "flow breaking structures are nested"

    Further reading

    Function _fill_in_five_prime has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
    Open

        def _fill_in_five_prime(self, nucleotides):
        stuffer = ""
        type, se = self.five_prime_end()
        if type == "5'":
            for n in _rc(se):
    Severity: Minor
    Found in src/pydna/dseq.py - About 35 mins to fix

    Cognitive Complexity

    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

    A method's cognitive complexity is based on a few simple rules:

    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
    • Code is considered more complex for each "break in the linear flow of the code"
    • Code is considered more complex when "flow breaking structures are nested"

    Further reading

    Function _fill_in_three_prime has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
    Open

        def _fill_in_three_prime(self, nucleotides):
        stuffer = ""
        type, se = self.three_prime_end()
        if type == "5'":
            for n in _rc(se):
    Severity: Minor
    Found in src/pydna/dseq.py - About 35 mins to fix

    Cognitive Complexity

    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

    A method's cognitive complexity is based on a few simple rules:

    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
    • Code is considered more complex for each "break in the linear flow of the code"
    • Code is considered more complex when "flow breaking structures are nested"

    Further reading

    Function memorize has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
    Open

    def memorize(filename):
    """Cache functions and classes.

    see pydna.download
    """
    Severity: Minor
    Found in src/pydna/utils.py - About 35 mins to fix

    Cognitive Complexity

    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

    A method's cognitive complexity is based on a few simple rules:

    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
    • Code is considered more complex for each "break in the linear flow of the code"
    • Code is considered more complex when "flow breaking structures are nested"

    Further reading

    Function assign_numbers has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
    Open

        def assign_numbers(self, lst: list):
        """Find new primers in lst.

        Returns a string containing new primers with their assigned
        numbers. This string can be copied and pasted to the primer
    Severity: Minor
    Found in src/pydna/myprimers.py - About 35 mins to fix

    Cognitive Complexity

    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

    A method's cognitive complexity is based on a few simple rules:

    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
    • Code is considered more complex for each "break in the linear flow of the code"
    • Code is considered more complex when "flow breaking structures are nested"

    Further reading

    Function list_parts has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
    Open

    def list_parts(fusion_pcr_fragment):
    stack = [fusion_pcr_fragment]
    processed = []

    while stack:
    Severity: Minor
    Found in src/pydna/fusionpcr.py - About 35 mins to fix

    Cognitive Complexity

    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

    A method's cognitive complexity is based on a few simple rules:

    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
    • Code is considered more complex for each "break in the linear flow of the code"
    • Code is considered more complex when "flow breaking structures are nested"

    Further reading

    Function __add__ has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
    Open

        def __add__(self, other):
        """Simulates ligation between two DNA fragments.

        Add other Dseq object at the end of the sequence.
        Type error is raised if any of the points below are fulfilled:
    Severity: Minor
    Found in src/pydna/dseq.py - About 35 mins to fix

    Cognitive Complexity

    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

    A method's cognitive complexity is based on a few simple rules:

    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
    • Code is considered more complex for each "break in the linear flow of the code"
    • Code is considered more complex when "flow breaking structures are nested"

    Further reading

    Function flatten has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
    Open

    def flatten(List):
    if List == []:
        return List
    flatL = []
    for elem in List:
    Severity: Minor
    Found in scripts/gel/gel_old.py - About 35 mins to fix

    Cognitive Complexity

    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

    A method's cognitive complexity is based on a few simple rules:

    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
    • Code is considered more complex for each "break in the linear flow of the code"
    • Code is considered more complex when "flow breaking structures are nested"

    Further reading

    Function figure has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
    Open

        def figure(self, feature=0, highlight="\x1b[48;5;11m", plain="\x1b[0m"):
        """docstring."""
        if self.features:
            f = self.features[feature]
            locations = sorted(self.features[feature].location.parts, key=_SimpleLocation.start.fget)
    Severity: Minor
    Found in src/pydna/dseqrecord.py - About 35 mins to fix

    Cognitive Complexity

    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

    A method's cognitive complexity is based on a few simple rules:

    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
    • Code is considered more complex for each "break in the linear flow of the code"
    • Code is considered more complex when "flow breaking structures are nested"

    Further reading

    Avoid too many return statements within this function.
    Open

            return True
    Severity: Major
    Found in src/pydna/dseq.py - About 30 mins to fix

      Function __init__ has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring.
      Open

          def __init__(
        self,
        initlist: Iterable = None,
        path: (str, Path) = None,
        *args,
      Severity: Minor
      Found in src/pydna/myprimers.py - About 25 mins to fix

      Cognitive Complexity

      Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

      A method's cognitive complexity is based on a few simple rules:

      • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
      • Code is considered more complex for each "break in the linear flow of the code"
      • Code is considered more complex when "flow breaking structures are nested"

      Further reading

      Function expose has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring.
      Open

          def expose(self, exposure=0.1, aperture=2):
        """Returns an image of the gel with the DNA highlighted"""

        c1, c2 = exposure * 100, exposure * 200
        fill_colour = (c1, c1, c2)
      Severity: Minor
      Found in scripts/experimental_gel2.py - About 25 mins to fix

      Cognitive Complexity

      Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

      A method's cognitive complexity is based on a few simple rules:

      • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
      • Code is considered more complex for each "break in the linear flow of the code"
      • Code is considered more complex when "flow breaking structures are nested"

      Further reading

      Function __call__ has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring.
      Open

          def __call__(cls, *args):
        t = (int(time.time()) // 10000) * 10000
        h = hash(args)
        fn = "%s/%s-%i-%i.pickle" % (tempfile.gettempdir(), cls.__name__, t, h)
      Severity: Minor
      Found in scripts/memo/meta.py - About 25 mins to fix

      Cognitive Complexity

      Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

      A method's cognitive complexity is based on a few simple rules:

      • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
      • Code is considered more complex for each "break in the linear flow of the code"
      • Code is considered more complex when "flow breaking structures are nested"

      Further reading

      Function __mul__ has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring.
      Open

          def __mul__(self, number):
        if not isinstance(number, int):
            raise TypeError("TypeError: can't multiply Dseqrecord by non-int of type {}".format(type(number)))
        if self.circular:
            raise TypeError("TypeError: can't multiply circular Dseqrecord.")
      Severity: Minor
      Found in src/pydna/dseqrecord.py - About 25 mins to fix

      Cognitive Complexity

      Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

      A method's cognitive complexity is based on a few simple rules:

      • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
      • Code is considered more complex for each "break in the linear flow of the code"
      • Code is considered more complex when "flow breaking structures are nested"

      Further reading

      Function figure has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring.
      Open

          def figure(self):
        r"""Compact ascii representation of the assembled fragments.

        Each fragment is represented by:
      Severity: Minor
      Found in src/pydna/contig.py - About 25 mins to fix

      Cognitive Complexity

      Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

      A method's cognitive complexity is based on a few simple rules:

      • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
      • Code is considered more complex for each "break in the linear flow of the code"
      • Code is considered more complex when "flow breaking structures are nested"

      Further reading

      Function parseGBLoc has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring.
      Open

      def parseGBLoc(s, l_, t):
    """retwingles parsed genbank location strings, assumes no joins of RC and FWD sequences"""
    strand = 1
    locationlist = []
      Severity: Minor
      Found in src/pydna/genbankfixer.py - About 25 mins to fix

      Cognitive Complexity

      Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

      A method's cognitive complexity is based on a few simple rules:

      • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
      • Code is considered more complex for each "break in the linear flow of the code"
      • Code is considered more complex when "flow breaking structures are nested"

      Further reading

      Function expose has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring.
      Open

          def expose(self, exposure=0.1, aperture=2):
        """Returns an image of the gel with the DNA highlighted"""

        c1, c2 = exposure * 100, exposure * 200
        fill_colour = (c1, c1, c2)
      Severity: Minor
      Found in scripts/experimental_gel.py - About 25 mins to fix

      Cognitive Complexity

      Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

      A method's cognitive complexity is based on a few simple rules:

      • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
      • Code is considered more complex for each "break in the linear flow of the code"
      • Code is considered more complex when "flow breaking structures are nested"

      Further reading

      Function parse has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring.
      Open

      def parse(data, ds=True):
    """Return *all* DNA sequences found in data.

    If no sequences are found, an empty list is returned. This is a greedy
    function, use carefully.
      Severity: Minor
      Found in src/pydna/parsers.py - About 25 mins to fix

      Cognitive Complexity

      Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

      A method's cognitive complexity is based on a few simple rules:

      • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
      • Code is considered more complex for each "break in the linear flow of the code"
      • Code is considered more complex when "flow breaking structures are nested"

      Further reading

      Severity
      Category
      Status
      Source
      Language