Sign upLogin

BjornFJohansson/pydna

View on GitHub
Star

Showing 219 of 219 total issues

Function all_simple_paths_edges has 5 arguments (exceeds 4 allowed). Consider refactoring.
Open

def all_simple_paths_edges(G, source, target, cutoff=None, data=False):
Severity: Minor
Found in scripts/_simple_paths8.py - About 35 mins to fix

    Function pore_size has 5 arguments (exceeds 4 allowed). Consider refactoring.
    Open

    def pore_size(gamma, muL, mu0, lp, b):
    Severity: Minor
    Found in scripts/gel/gel_old.py - About 35 mins to fix

      Function from_string has 5 arguments (exceeds 4 allowed). Consider refactoring.
      Open

          def from_string(cls, record: str = "", *args, graph=None, nodemap=None, **kwargs):
      Severity: Minor
      Found in src/pydna/contig.py - About 35 mins to fix

        Function from_SeqRecord has 5 arguments (exceeds 4 allowed). Consider refactoring.
        Open

            def from_SeqRecord(cls, record, *args, graph=None, nodemap=None, **kwargs):
        Severity: Minor
        Found in src/pydna/contig.py - About 35 mins to fix

          Function quick has 5 arguments (exceeds 4 allowed). Consider refactoring.
          Open

              def quick(
          Severity: Minor
          Found in src/pydna/dseq.py - About 35 mins to fix

            Function from_string has 5 arguments (exceeds 4 allowed). Consider refactoring.
            Open

                def from_string(
            Severity: Minor
            Found in src/pydna/dseq.py - About 35 mins to fix

              Function diffusion_coefficient has 5 arguments (exceeds 4 allowed). Consider refactoring.
              Open

              def diffusion_coefficient(Nbp, N_lim1, N_lim2, N_lim3, args):
              Severity: Minor
              Found in scripts/gel/gel_old.py - About 35 mins to fix

                Function __init__ has 5 arguments (exceeds 4 allowed). Consider refactoring.
                Open

                    def __init__(self, record, *args, graph=None, nodemap=None, **kwargs):
                Severity: Minor
                Found in src/pydna/contig.py - About 35 mins to fix

                  Function translate has 5 arguments (exceeds 4 allowed). Consider refactoring.
                  Open

                      def translate(self, table="Standard", stop_symbol="*", to_stop=False, cds=False, gap="-"):
                  Severity: Minor
                  Found in src/pydna/dseq.py - About 35 mins to fix

                    Function flatten has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
                    Open

                    def flatten(List):
    if List == []:
        return List
    flatL = []
    for elem in List:
                    Severity: Minor
                    Found in scripts/gel/gel_old.py - About 35 mins to fix

                    Cognitive Complexity

                    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

                    A method's cognitive complexity is based on a few simple rules:

                    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
                    • Code is considered more complex for each "break in the linear flow of the code"
                    • Code is considered more complex when "flow breaking structures are nested"

                    Further reading

                    Function assign_numbers has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
                    Open

                        def assign_numbers(self, lst: list):
        """Find new primers in lst.

        Returns a string containing new primers with their assigned
        numbers. This string can be copied and pasted to the primer
                    Severity: Minor
                    Found in src/pydna/myprimers.py - About 35 mins to fix

                    Cognitive Complexity

                    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

                    A method's cognitive complexity is based on a few simple rules:

                    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
                    • Code is considered more complex for each "break in the linear flow of the code"
                    • Code is considered more complex when "flow breaking structures are nested"

                    Further reading

                    Function list_parts has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
                    Open

                    def list_parts(fusion_pcr_fragment):
    stack = [fusion_pcr_fragment]
    processed = []

    while stack:
                    Severity: Minor
                    Found in src/pydna/fusionpcr.py - About 35 mins to fix

                    Cognitive Complexity

                    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

                    A method's cognitive complexity is based on a few simple rules:

                    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
                    • Code is considered more complex for each "break in the linear flow of the code"
                    • Code is considered more complex when "flow breaking structures are nested"

                    Further reading

                    Identical blocks of code found in 2 locations. Consider refactoring.
                    Open

                            from_x = int(round(((distXmid - bandlength / 2.0) * res).magnitude))
                    Severity: Minor
                    Found in scripts/gel/gel_old.py and 1 other location - About 35 mins to fix
                    scripts/gel/gel2.py on lines 434..434

                    Duplicated Code

                    Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:

                    Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.

                    When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).

                    Tuning

                    This issue has a mass of 33.

                    We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.

                    The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.

                    If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.

                    See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.

                    Refactorings

                    Further Reading

                    Identical blocks of code found in 2 locations. Consider refactoring.
                    Open

                        return kB * T / (6 * _np.pi * eta * Rh)
                    Severity: Minor
                    Found in scripts/gel/gel_old.py and 1 other location - About 35 mins to fix
                    scripts/gel/gel2.py on lines 179..179

                    Duplicated Code

                    Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:

                    Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.

                    When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).

                    Tuning

                    This issue has a mass of 33.

                    We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.

                    The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.

                    If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.

                    See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.

                    Refactorings

                    Further Reading

                    Similar blocks of code found in 5 locations. Consider refactoring.
                    Open

                        datasets[name]["muL"] = temp_dset["muL"] * ureg("1.0E-8 m**2/(V*s)")
                    Severity: Major
                    Found in scripts/gel/gel_old.py and 4 other locations - About 35 mins to fix
                    scripts/gel/gel_old.py on lines 348..348
                    scripts/gel/gel_old.py on lines 349..349
                    scripts/gel/gel_old.py on lines 350..350
                    scripts/gel/gel_old.py on lines 352..352

                    Duplicated Code

                    Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:

                    Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.

                    When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).

                    Tuning

                    This issue has a mass of 33.

                    We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.

                    The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.

                    If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.

                    See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.

                    Refactorings

                    Further Reading

                    Similar blocks of code found in 5 locations. Consider refactoring.
                    Open

                        datasets[name]["gamma"] = temp_dset["gamma"] * ureg("kbp")
                    Severity: Major
                    Found in scripts/gel/gel_old.py and 4 other locations - About 35 mins to fix
                    scripts/gel/gel_old.py on lines 348..348
                    scripts/gel/gel_old.py on lines 349..349
                    scripts/gel/gel_old.py on lines 350..350
                    scripts/gel/gel_old.py on lines 351..351

                    Duplicated Code

                    Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:

                    Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.

                    When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).

                    Tuning

                    This issue has a mass of 33.

                    We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.

                    The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.

                    If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.

                    See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.

                    Refactorings

                    Further Reading

                    Function figure has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
                    Open

                        def figure(self, feature=0, highlight="\x1b[48;5;11m", plain="\x1b[0m"):
        """docstring."""
        if self.features:
            f = self.features[feature]
            locations = sorted(self.features[feature].location.parts, key=_SimpleLocation.start.fget)
                    Severity: Minor
                    Found in src/pydna/dseqrecord.py - About 35 mins to fix

                    Cognitive Complexity

                    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

                    A method's cognitive complexity is based on a few simple rules:

                    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
                    • Code is considered more complex for each "break in the linear flow of the code"
                    • Code is considered more complex when "flow breaking structures are nested"

                    Further reading

                    Function search has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
                    Open

                        def search(self, dna, linear=True):
        """docstring."""
        dna = str(dna).upper()
        if linear:
            dna = dna
                    Severity: Minor
                    Found in src/pydna/crispr.py - About 35 mins to fix

                    Cognitive Complexity

                    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

                    A method's cognitive complexity is based on a few simple rules:

                    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
                    • Code is considered more complex for each "break in the linear flow of the code"
                    • Code is considered more complex when "flow breaking structures are nested"

                    Further reading

                    Identical blocks of code found in 2 locations. Consider refactoring.
                    Open

                                    to_x = int(round(((distXmid + bandlength / 2.0) * res).magnitude))
                    Severity: Minor
                    Found in scripts/gel/gel2.py and 1 other location - About 35 mins to fix
                    scripts/gel/gel_old.py on lines 1000..1000

                    Duplicated Code

                    Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:

                    Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.

                    When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).

                    Tuning

                    This issue has a mass of 33.

                    We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.

                    The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.

                    If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.

                    See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.

                    Refactorings

                    Further Reading

                    Function find_aminoacids has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.
                    Open

                        def find_aminoacids(self, other):
        """
        >>> from pydna.dseqrecord import Dseqrecord
        >>> s=Dseqrecord("atgtacgatcgtatgctggttatattttag")
        >>> s.seq.translate()
                    Severity: Minor
                    Found in src/pydna/dseqrecord.py - About 35 mins to fix

                    Cognitive Complexity

                    Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.

                    A method's cognitive complexity is based on a few simple rules:

                    • Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
                    • Code is considered more complex for each "break in the linear flow of the code"
                    • Code is considered more complex when "flow breaking structures are nested"

                    Further reading

                    Severity
                    Category
                    Status
                    Source
                    Language