Showing 219 of 219 total issues
Function add_feature has 7 arguments (exceeds 4 allowed). Consider refactoring. Open
def add_feature(self, x=None, y=None, seq=None, type_="misc", strand=1, *args, **kwargs):Avoid deeply nested control flow statements. Open
if not forwdYstop:
distYfor = Q_(pxlYfor, "px") / res
forYI = Gaussian(distYfor, maxI, distYmid, std_dev)
rgb_arr[pxlYfor, from_x:to_x] += forYI
pxlYfor += 1Function list_features has a Cognitive Complexity of 8 (exceeds 5 allowed). Consider refactoring. Open
def list_features(self):
"""Print ASCII table with all features.
Examples
--------- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function from_string has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def from_string(Avoid deeply nested control flow statements. Open
if forYI <= Itol or pxlYfor == pxl_y:
forwdYstop = True
# Background color
if noise is None or noise <= 0:Avoid deeply nested control flow statements. Open
if k in [
"ApEinfo_label",
"ApEinfo_fwdcolor",
"ApEinfo_revcolor",
"label",Function looped has a Cognitive Complexity of 8 (exceeds 5 allowed). Consider refactoring. Open
def looped(self):
"""
Circular version of the Dseqrecord object.
The underlying linear Dseq object has to have compatible ends.- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Avoid deeply nested control flow statements. Open
if bckYI <= Itol or pxlYbck == -1:
bckwdYstop = True
if not forwdYstop:Function __init__ has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def __init__(Avoid deeply nested control flow statements. Open
if f.location.start > len(ct) and f.location.end > len(ct):
f.location += -len(ct)
elif f.location.end > len(ct):
f.location = _CompoundLocation(
(Function nucleotide has a Cognitive Complexity of 8 (exceeds 5 allowed). Consider refactoring. Open
def nucleotide(self, item: str, seq_start=None, seq_stop=None, strand=1):
"""This method downloads a genbank nuclotide record from genbank. This method is
cached by default. This can be controlled by editing the **pydna_cached_funcs** environment
variable. The best way to do this permanently is to edit the edit the
`pydna.ini` file. See the documentation of :func:`pydna.open_config_folder`- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function Zimm_g has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def Zimm_g(Nbp, DRouse, qeff, mu0, kB, T):Avoid deeply nested control flow statements. Open
if pxlYbck < len(rgb_arr):
rgb_arr[pxlYbck, from_x:to_x] += bckYI
pxlYbck -= 1Avoid deeply nested control flow statements. Open
if not bckwdYstop:
distYbck = Q_(pxlYbck, "px") / res
bckYI = Gaussian(distYbck, maxI, distYmid, std_dev)
if pxlYbck < len(rgb_arr):
rgb_arr[pxlYbck, from_x:to_x] += bckYIFunction __init__ has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def __init__(self, record, *args, amplicon=None, position=None, footprint=0, **kwargs):Function __str__ has a Cognitive Complexity of 8 (exceeds 5 allowed). Consider refactoring. Open
def __str__(self):
"""returns a short report describing if or where primer
anneal on the template."""
mystring = "Template {name} {size} bp {top} limit={limit}:\n".format(- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function reduced_field has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def reduced_field(eta, a, mu0, E, kB, T):Function reduced_field_Kuhn has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def reduced_field_Kuhn(eta, l, mu0, E, kB, T):Function __init__ has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def __init__(self, record, *args, template=None, forward_primer=None, reverse_primer=None, **kwargs):Avoid deeply nested control flow statements. Open
if isinstance(val, str):
dct[key] = a[key].strip()
nl.append(dct)Function from_SeqRecord has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def from_SeqRecord(Function __init__ has 6 arguments (exceeds 4 allowed). Consider refactoring. Open
def __init__(self, seq, *args, id="id", name="name", description="description", **kwargs):Similar blocks of code found in 4 locations. Consider refactoring. Open
if pxlYbck < len(rgb_arr):
rgb_arr[pxlYbck, from_x:to_x] += bckYI- Read upRead up
Duplicated Code
Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:
Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.
When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).
Tuning
This issue has a mass of 34.
We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.
The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.
If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.
See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.
Refactorings
- Extract Method
- Extract Class
- Form Template Method
- Introduce Null Object
- Pull Up Method
- Pull Up Field
- Substitute Algorithm
Further Reading
- Don't Repeat Yourself on the C2 Wiki
- Duplicated Code on SourceMaking
- Refactoring: Improving the Design of Existing Code by Martin Fowler. Duplicated Code, p76
Similar blocks of code found in 4 locations. Consider refactoring. Open
if pxlYmid < len(rgb_arr): # band within gel frontiers
rgb_arr[pxlYmid, from_x:to_x] += midI- Read upRead up
Duplicated Code
Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:
Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.
When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).
Tuning
This issue has a mass of 34.
We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.
The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.
If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.
See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.
Refactorings
- Extract Method
- Extract Class
- Form Template Method
- Introduce Null Object
- Pull Up Method
- Pull Up Field
- Substitute Algorithm
Further Reading
- Don't Repeat Yourself on the C2 Wiki
- Duplicated Code on SourceMaking
- Refactoring: Improving the Design of Existing Code by Martin Fowler. Duplicated Code, p76
Similar blocks of code found in 4 locations. Consider refactoring. Open
if pxlYmid < len(rgb_arr): # band within gel frontiers
rgb_arr[pxlYmid, from_x:to_x] += midI- Read upRead up
Duplicated Code
Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:
Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.
When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).
Tuning
This issue has a mass of 34.
We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.
The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.
If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.
See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.
Refactorings
- Extract Method
- Extract Class
- Form Template Method
- Introduce Null Object
- Pull Up Method
- Pull Up Field
- Substitute Algorithm
Further Reading
- Don't Repeat Yourself on the C2 Wiki
- Duplicated Code on SourceMaking
- Refactoring: Improving the Design of Existing Code by Martin Fowler. Duplicated Code, p76
Similar blocks of code found in 4 locations. Consider refactoring. Open
if pxlYbck < len(rgb_arr):
rgb_arr[pxlYbck, from_x:to_x] += bckYI- Read upRead up
Duplicated Code
Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:
Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.
When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).
Tuning
This issue has a mass of 34.
We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.
The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.
If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.
See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.
Refactorings
- Extract Method
- Extract Class
- Form Template Method
- Introduce Null Object
- Pull Up Method
- Pull Up Field
- Substitute Algorithm
Further Reading
- Don't Repeat Yourself on the C2 Wiki
- Duplicated Code on SourceMaking
- Refactoring: Improving the Design of Existing Code by Martin Fowler. Duplicated Code, p76
Function translate has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def translate(self, table="Standard", stop_symbol="*", to_stop=False, cds=False, gap="-"):Function __init__ has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def __init__(self, record, *args, graph=None, nodemap=None, **kwargs):Function pore_size has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def pore_size(gamma, muL, mu0, lp, b):Function tmbresluc has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def tmbresluc(primer: str, *args, primerc=500.0, saltc=50, **kwargs):Function from_string has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def from_string(Function ta_dbd has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def ta_dbd(fp, rp, seq, tm=tm_dbd, tm_product=None):Function __init__ has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def __init__(Function all_simple_paths_edges has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def all_simple_paths_edges(G, source, target, cutoff=None, data=False):Function from_SeqRecord has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def from_SeqRecord(cls, record, *args, graph=None, nodemap=None, **kwargs):Function ta_default has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def ta_default(fp: str, rp: str, seq: str, tm=tm_default, tm_product=tm_product):Function diffusion_coefficient has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def diffusion_coefficient(Nbp, N_lim1, N_lim2, N_lim3, args):Function from_string has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def from_string(cls, record: str = "", *args, graph=None, nodemap=None, **kwargs):Function quick has 5 arguments (exceeds 4 allowed). Consider refactoring. Open
def quick(Function list_parts has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def list_parts(fusion_pcr_fragment):
stack = [fusion_pcr_fragment]
processed = []
while stack:- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function find_aminoacids has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def find_aminoacids(self, other):
"""
>>> from pydna.dseqrecord import Dseqrecord
>>> s=Dseqrecord("atgtacgatcgtatgctggttatattttag")
>>> s.seq.translate()- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Function _fill_in_three_prime has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def _fill_in_three_prime(self, nucleotides):
stuffer = ""
type, se = self.three_prime_end()
if type == "5'":
for n in _rc(se):- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Identical blocks of code found in 2 locations. Consider refactoring. Open
free_solution = lambda kB, T, eta, Rh: kB * T / (6 * _np.pi * eta * Rh)- Read upRead up
Duplicated Code
Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:
Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.
When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).
Tuning
This issue has a mass of 33.
We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.
The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.
If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.
See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.
Refactorings
- Extract Method
- Extract Class
- Form Template Method
- Introduce Null Object
- Pull Up Method
- Pull Up Field
- Substitute Algorithm
Further Reading
- Don't Repeat Yourself on the C2 Wiki
- Duplicated Code on SourceMaking
- Refactoring: Improving the Design of Existing Code by Martin Fowler. Duplicated Code, p76
Similar blocks of code found in 5 locations. Consider refactoring. Open
datasets[name]["gamma"] = temp_dset["gamma"] * ureg("kbp")- Read upRead up
Duplicated Code
Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:
Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.
When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).
Tuning
This issue has a mass of 33.
We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.
The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.
If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.
See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.
Refactorings
- Extract Method
- Extract Class
- Form Template Method
- Introduce Null Object
- Pull Up Method
- Pull Up Field
- Substitute Algorithm
Further Reading
- Don't Repeat Yourself on the C2 Wiki
- Duplicated Code on SourceMaking
- Refactoring: Improving the Design of Existing Code by Martin Fowler. Duplicated Code, p76
Function assign_numbers has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def assign_numbers(self, lst: list):
"""Find new primers in lst.
Returns a string containing new primers with their assigned
numbers. This string can be copied and pasted to the primer- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Identical blocks of code found in 2 locations. Consider refactoring. Open
to_x = int(round(((distXmid + bandlength / 2.0) * res).magnitude))- Read upRead up
Duplicated Code
Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:
Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.
When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).
Tuning
This issue has a mass of 33.
We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.
The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.
If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.
See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.
Refactorings
- Extract Method
- Extract Class
- Form Template Method
- Introduce Null Object
- Pull Up Method
- Pull Up Field
- Substitute Algorithm
Further Reading
- Don't Repeat Yourself on the C2 Wiki
- Duplicated Code on SourceMaking
- Refactoring: Improving the Design of Existing Code by Martin Fowler. Duplicated Code, p76
Function figure has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring. Open
def figure(self, feature=0, highlight="\x1b[48;5;11m", plain="\x1b[0m"):
"""docstring."""
if self.features:
f = self.features[feature]
locations = sorted(self.features[feature].location.parts, key=_SimpleLocation.start.fget)- Read upRead up
Cognitive Complexity
Cognitive Complexity is a measure of how difficult a unit of code is to intuitively understand. Unlike Cyclomatic Complexity, which determines how difficult your code will be to test, Cognitive Complexity tells you how difficult your code will be to read and comprehend.
A method's cognitive complexity is based on a few simple rules:
- Code is not considered more complex when it uses shorthand that the language provides for collapsing multiple statements into one
- Code is considered more complex for each "break in the linear flow of the code"
- Code is considered more complex when "flow breaking structures are nested"
Further reading
Similar blocks of code found in 5 locations. Consider refactoring. Open
datasets[name]["muL"] = temp_dset["muL"] * ureg("1.0E-8 m**2/(V*s)")- Read upRead up
Duplicated Code
Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:
Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.
When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).
Tuning
This issue has a mass of 33.
We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.
The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.
If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.
See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.
Refactorings
- Extract Method
- Extract Class
- Form Template Method
- Introduce Null Object
- Pull Up Method
- Pull Up Field
- Substitute Algorithm
Further Reading
- Don't Repeat Yourself on the C2 Wiki
- Duplicated Code on SourceMaking
- Refactoring: Improving the Design of Existing Code by Martin Fowler. Duplicated Code, p76
Identical blocks of code found in 2 locations. Consider refactoring. Open
return kB * T / (6 * _np.pi * eta * Rh)- Read upRead up
Duplicated Code
Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:
Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.
When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).
Tuning
This issue has a mass of 33.
We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.
The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.
If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.
See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.
Refactorings
- Extract Method
- Extract Class
- Form Template Method
- Introduce Null Object
- Pull Up Method
- Pull Up Field
- Substitute Algorithm
Further Reading
- Don't Repeat Yourself on the C2 Wiki
- Duplicated Code on SourceMaking
- Refactoring: Improving the Design of Existing Code by Martin Fowler. Duplicated Code, p76
Identical blocks of code found in 2 locations. Consider refactoring. Open
to_x = int(round(((distXmid + bandlength / 2.0) * res).magnitude))- Read upRead up
Duplicated Code
Duplicated code can lead to software that is hard to understand and difficult to change. The Don't Repeat Yourself (DRY) principle states:
Every piece of knowledge must have a single, unambiguous, authoritative representation within a system.
When you violate DRY, bugs and maintenance problems are sure to follow. Duplicated code has a tendency to both continue to replicate and also to diverge (leaving bugs as two similar implementations differ in subtle ways).
Tuning
This issue has a mass of 33.
We set useful threshold defaults for the languages we support but you may want to adjust these settings based on your project guidelines.
The threshold configuration represents the minimum mass a code block must have to be analyzed for duplication. The lower the threshold, the more fine-grained the comparison.
If the engine is too easily reporting duplication, try raising the threshold. If you suspect that the engine isn't catching enough duplication, try lowering the threshold. The best setting tends to differ from language to language.
See codeclimate-duplication's documentation for more information about tuning the mass threshold in your .codeclimate.yml.
Refactorings
- Extract Method
- Extract Class
- Form Template Method
- Introduce Null Object
- Pull Up Method
- Pull Up Field
- Substitute Algorithm
Further Reading
- Don't Repeat Yourself on the C2 Wiki
- Duplicated Code on SourceMaking
- Refactoring: Improving the Design of Existing Code by Martin Fowler. Duplicated Code, p76