File dseqrecord.py has 1063 lines of code (exceeds 250 allowed). Consider refactoring.

Open

#!/usr/bin/env python3
# -*- coding: utf-8 -*-
# Copyright 2013-2023 by Björn Johansson.  All rights reserved.
# This code is part of the Python-dna distribution and governed by its
# license.  Please see the LICENSE.txt file that should have been included

Dseqrecord has 47 functions (exceeds 20 allowed). Consider refactoring.

Open

class Dseqrecord(_SeqRecord):
    """Dseqrecord is a double stranded version of the Biopython SeqRecord [#]_ class.
    The Dseqrecord object holds a Dseq object describing the sequence.
    Additionally, Dseqrecord hold meta information about the sequence in the
    from of a list of SeqFeatures, in the same way as the SeqRecord does.

Function map_trace_files has a Cognitive Complexity of 34 (exceeds 5 allowed). Consider refactoring.

Open

    def map_trace_files(self, pth, limit=25):  # TODO allow path-like objects
        import glob

        traces = []
        for name in glob.glob(pth):

• Read up
  Read up

Function __init__ has a Cognitive Complexity of 17 (exceeds 5 allowed). Consider refactoring.

Open

    def __init__(
        self,
        record,
        *args,
        # linear=None,

• Read up
  Read up

Function write has a Cognitive Complexity of 16 (exceeds 5 allowed). Consider refactoring.

Open

    def write(self, filename=None, f="gb"):
        """Writes the Dseqrecord to a file using the format f, which must
        be a format supported by Biopython SeqIO for writing [#]_. Default
        is "gb" which is short for Genbank. Note that Biopython SeqIO reads
        more formats than it writes.

• Read up
  Read up

Function synced has a Cognitive Complexity of 15 (exceeds 5 allowed). Consider refactoring.

Open

    def synced(self, ref, limit=25):
        """This method returns a new circular sequence (Dseqrecord object), which has been rotated
        in such a way that there is maximum overlap between the sequence and
        ref, which may be a string, Biopython Seq, SeqRecord object or
        another Dseqrecord object.

• Read up
  Read up

Function __getitem__ has a Cognitive Complexity of 13 (exceeds 5 allowed). Consider refactoring.

Open

    def __getitem__(self, sl):
        """docstring."""
        answer = Dseqrecord(_copy.copy(self))
        answer.seq = self.seq.__getitem__(sl)
        # answer.seq.alphabet = self.seq.alphabet

• Read up
  Read up

Function apply_cut has a Cognitive Complexity of 13 (exceeds 5 allowed). Consider refactoring.

Open

    def apply_cut(self, left_cut, right_cut):
        dseq = self.seq.apply_cut(left_cut, right_cut)
        # TODO: maybe remove depending on https://github.com/BjornFJohansson/pydna/issues/161

        if left_cut == right_cut:

• Read up
  Read up

Function __add__ has a Cognitive Complexity of 11 (exceeds 5 allowed). Consider refactoring.

Open

    def __add__(self, other):
        if hasattr(other, "seq") and hasattr(other.seq, "watson"):
            other = _copy.deepcopy(other)
            other_five_prime = other.seq.five_prime_end()
            if other_five_prime[0] == "5'":

• Read up
  Read up

Function __contains__ has a Cognitive Complexity of 9 (exceeds 5 allowed). Consider refactoring.

Open

    def __contains__(self, other):
        if other.lower() in str(self.seq).lower():
            return True
        else:
            s = self.seq.watson.replace(" ", "")

• Read up
  Read up

Function __init__ has 7 arguments (exceeds 4 allowed). Consider refactoring.

Open

    def __init__(

Function add_feature has 7 arguments (exceeds 4 allowed). Consider refactoring.

Open

    def add_feature(self, x=None, y=None, seq=None, type_="misc", strand=1, *args, **kwargs):

Function from_string has 6 arguments (exceeds 4 allowed). Consider refactoring.

Open

    def from_string(

Function looped has a Cognitive Complexity of 8 (exceeds 5 allowed). Consider refactoring.

Open

    def looped(self):
        """
        Circular version of the Dseqrecord object.

        The underlying linear Dseq object has to have compatible ends.

• Read up
  Read up

Function from_SeqRecord has 6 arguments (exceeds 4 allowed). Consider refactoring.

Open

    def from_SeqRecord(

Function figure has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.

Open

    def figure(self, feature=0, highlight="\x1b[48;5;11m", plain="\x1b[0m"):
        """docstring."""
        if self.features:
            f = self.features[feature]
            locations = sorted(self.features[feature].location.parts, key=_SimpleLocation.start.fget)

• Read up
  Read up

Function find_aminoacids has a Cognitive Complexity of 7 (exceeds 5 allowed). Consider refactoring.

Open

    def find_aminoacids(self, other):
        """
        >>> from pydna.dseqrecord import Dseqrecord
        >>> s=Dseqrecord("atgtacgatcgtatgctggttatattttag")
        >>> s.seq.translate()

• Read up
  Read up

Function __mul__ has a Cognitive Complexity of 6 (exceeds 5 allowed). Consider refactoring.

Open

    def __mul__(self, number):
        if not isinstance(number, int):
            raise TypeError("TypeError: can't multiply Dseqrecord by non-int of type {}".format(type(number)))
        if self.circular:
            raise TypeError("TypeError: can't multiply circular Dseqrecord.")

• Read up
  Read up